Powder: -20°C for 3 years | In solvent: -80°C for 1 year
Bepirovirsen, an antisense oligonucleotide, targets all HBV messenger RNAs, resulting in decreased levels of HBV-derived RNAs, HBV DNA, and viral proteins. It is utilized in researching chronic HBV infection. The binding site sequence of Bepirovirsen is (GCACTTCGCTTCACCTCTGC) [1].
Pack Size | Availability | Price/USD | Quantity |
---|---|---|---|
5 mg | Inquiry | Inquiry | |
50 mg | Inquiry | Inquiry |
Description | Bepirovirsen, an antisense oligonucleotide, targets all HBV messenger RNAs, resulting in decreased levels of HBV-derived RNAs, HBV DNA, and viral proteins. It is utilized in researching chronic HBV infection. The binding site sequence of Bepirovirsen is (GCACTTCGCTTCACCTCTGC) [1]. |
Molecular Weight | 7344 |
CAS No. | 1403787-62-1 |
Powder: -20°C for 3 years | In solvent: -80°C for 1 year
You can also refer to dose conversion for different animals. More
bottom
Please see Inhibitor Handling Instructions for more frequently ask questions. Topics include: how to prepare stock solutions, how to store products, and cautions on cell-based assays & animal experiments, etc.
Bepirovirsen 1403787-62-1 inhibitor inhibit